User Tools

Site Tools



Sequencing data

Library Run Location Notes


File Size
SW019_TGGCAAT_R1.fastq 40G
SW019_TGGCAAT_R2.fastq 40G
../preqc/ucsf_sw019/ucsf_sw019.fastq 81G
../adapterAndPCRFreeFiles/SW019_noAdap_R1.fastq 39G
../adapterAndPCRFreeFiles/SW019_noAdap_R2.fastq 39G
../adapterAndPCRFreeFiles/UCSF_SW019_noAdap_noDup_R1.fastq 39G
../adapterAndPCRFreeFiles/UCSF_SW019_noAdap_noDup_R2.fastq 39G
../merging/SeqPrep_newData/UCSF_SW019_TGGCAAT_merged.fastq.gz 14G
../merging/SeqPrep_newData/UCSF_SW019_TGGCAAT_R1_trimmed.fastq.gz 5G
../merging/SeqPrep_newData/UCSF_SW019_TGGCAAT_R2_trimmed.fastq.gz 4.9G
ErrorCorrected/SW019_seqprep_dupRemoved_ec_R1.fastq 37G
ErrorCorrected/SW019_seqprep_dupRemoved_ec_R2.fastq 37G

5/23- I am noticing that the SeqPrep_newData R1 and R2 file sizes differ, how did this happen? I have had some programs crash when the R1 and R2 do not match 1 to 1.

Fastqc results

Preqc (SGA preprocessing) results


The preqc report for the ucsf_sw019 reads look similar to previous reports. However, the genome size estimate is low (1.9 compared 2.2 Gb). The ucsf_sw019 is not represented in the k-de Bruijn graphs indicating insufficient coverage to make these predictions. This report provides a useful baseline for comparison with other pre-processing efforts.

Pre processing

The raw fastq files were put through a pre processing pipeline. First the fastq files had adaptor sequences removed using Skewer. The adaptor free files were further processed with FastUniq to remove PCR duplicates.


Running the merged and trimmed files

predicted best k: 61

KmerGenie Merged SW018 SW019

SeqPrep results

The data files were trimmed using SeqPrep, both with and without merging. The output for the run without merging is in /campusdata/BME235/Spring2015Data/adapter_trimming/SeqPrep_newData and the output for the run with merging is in /campusdata/BME235/Spring2015Data/merging/SeqPrep_newData. The trimmed R1 and R2 files for the run with merging are significantly smaller than those from the non-merging run.

The adapters used for both runs were AGATCGGAAGAGCACACGTCTGAACTCCAG (-A option) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAG (-B option).

Merged SW019 Libraries

All SW019 data sets that had been adapter trimmed using Seqprep were merged with Fastuniq to remove duplicates and then error corrected using Musket

You could leave a comment if you were logged in.
data_overview/2015/ucsf_sw019.txt · Last modified: 2015/07/16 11:49 by ceisenhart