User Tools

Site Tools


data_overview:2015:ucsf_bs-tag

BS-tag

Sequencing data

Library Run Location Notes
/campusdata/BME235/Spring2015Data/UCSF_BS-tag/

Adapter sequences:

Tn5ME-A (Illumina FC-121-1030): 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'

Tn5ME-B (Illumina FC-121-1031): 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG- 3'

Files

File Size
BS-tag_GTAGAGG_R1.fastq 36G
BS-tag_GTAGAGG_R2.fastq 36G
../preqc/ucsf_bs-tag/ucsf_bs-tag.fastq 74G
../adapter_trimming/UCSF_reads_skewer_trimmed/BS_tag_noAdap_pair1.fastq 36G
../adapter_trimming/UCSF_reads_skewer_trimmed/BS_tag_noAdap_pair2.fastq 36G
../merging/SeqPrep_newData/UCSF_BS-tag_GTAGAGG_merged.fastq.gz 7.5G
../merging/SeqPrep_newData/UCSF_BS-tag_GTAGAGG_R1_trimmed.fastq.gz 3.0G
../merging/SeqPrep_newData/UCSF_BS-tag_GTAGAGG_R2_trimmed.fastq.gz 3.0G
/campusdata/BME235/Spring2015Data/ErrorCorrected/BS-tag_seqprep_dupRemoved_ec_R1.fastq 9.0G
/campusdata/BME235/Spring2015Data/ErrorCorrected/BS-tag_seqprep_dupRemoved_ec_R2.fastq 9.0G

FastQC results

Results of the run are located here on the campusrocks2 server:

/campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc

fastqc_bs-tag_gtagagg_r1.pdf

fastqc_bs-tag_gtagagg_r2.pdf

Results of fastqc on adapter trimmed (with skewer) and PCR duplicate removed (with Fastuniq)

fastqc_bs_tag_noadap_pair1.pdf

fastqc_bs_tag_noadap_pair2.pdf

Preqc (SGA preprocessing) results

Sun May 24

ucsf_bs-tag_preqc_report.pdf

Preqc report was also run for the UCSF BS-MK and BS-tag data (pooled).

ucsf_new_lib_preqc_report.pdf

Comments

The preqc report for the ucsf_bs-tag reads look similar to previous reports. The ucsf_bs-tag is not represented in the k-de Bruijn graphs indicating insufficient coverage to make these predictions. This report provides a useful baseline for comparison with other pre-processing efforts.

SeqPrep results

The data files were trimmed using SeqPrep, both with and without merging. The output for the run without merging is in /campusdata/BME235/Spring2015Data/adapter_trimming/SeqPrep_newData and the output for the run with merging is in /campusdata/BME235/Spring2015Data/merging/SeqPrep_newData. The trimmed R1 and R2 files for the run with merging are much smaller than those from the non-merging run.

The adapters used for both runs were CTGTCTCTTATACACATCTCCGAGCCCACGAGAC (-A option) and CTGTCTCTTATACACATCTGACGCTGCCGACGA (-B option).

FastQC on Seqprep, Fastuniq, Musket processed files

Seqprep adapter removed files were run through Fastuniq to remove PCR duplicates, then through musket for error correction, and lastly FastQC for analysis

fastqc_bs-tag_seqprep_dupremoved_r1.pdf

fastqc_bs-tag_seqprep_dupremoved_r2.pdf

You could leave a comment if you were logged in.
data_overview/2015/ucsf_bs-tag.txt · Last modified: 2015/07/16 11:48 by ceisenhart