Table of Contents
Sequencing data
| Library | Run | Location | Notes |
| SW042 | /campusdata/BME235/Spring2015Data/ | Mate pair library. Expected insert size is 5-6kb. |
Files
| File | Size | Reads |
| SW042.r1.trimmed.fastq | 152M | 1,036,699 |
| SW042.r2.trimmed.fastq | 153M | 1,086,654 |
| Matepair_trimmed/skewer_run2_SW042_1_trimmed-pair1.fastq | 145M | 735,906 |
| Matepair_trimmed/skewer_run2_SW042_1-trimmed-pair2.fastq | 140M | 735,906 |
| Matepair_dupRemoved/skewer_42_dupRemoved_R1.fastq | 129M | 657,883 |
| Matepair_dupRemoved/skewer_42_dupRemoved_R2.fastq | 125M | 657,883 |
Note: Duplicates, concatemers, and linkers have already been removed in the “trimmed” files.
FastQC analysis
There are several summary statistics that fastqc flags as potentially unusual such as the per base sequence content and kmer content.
PreQC analysis
Run on SW042.r1.trimmed.fastq and SW042.r2.trimmed.fastq
Insert size distribution
The distribution of insert sizes for inward facing, outward facing, and same strand reads is shown below. Mate pairs should be outward facing.
To generate this distribution, mates pairs were mapped to all the soapdenovo “run 1” contigs using bwa. The orientation of reads was pulled from the resulting sam file using a script from the Green lab.
Pre-processing
Adapter Removal with Skewer
Running skewer with a junction sequence of
CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG
skewer-0.1.123-linux-x86_64 -x CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -y CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -m mp -j CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -t 32 -o ${OUTDIR} /campusdata/BME235/Spring2015Data/SW042.r1.trimmed.fastq /campusdata/BME235/Spring2015Data/SW042.r2.trimmed.fastq
Using the adapter sequences obtained from this paper Nextera Mate Pair Kit
Files located here:
/campusdata/BME235/Spring2015Data/Matepair_trimmed/skewer_run2_SW042_1-trimmed-pair1.fastq
/campusdata/BME235/Spring2015Data/Matepair_trimmed/skewer_run2_SW042_1-trimmed-pair2.fastq
Fastqc results
Fastuniq to remove duplicates
Fastuniq was run to remove any duplicates still remaining after adapter removal
Files located here:
/campusdata/Spring2015Data/Matepair_dupRemoved/skewer_42_dupRemoved_R1.fastq
/campusdata/Spring2015Data/Matepair_dupRemoved/skewer_42_dupRemoved_R2.fastq
Fastqc results
