User Tools

Site Tools


contributors:team_5:10_blast

BLASTN 2.2.31+

Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and

Webb Miller (2000), “A greedy algorithm for aligning DNA

sequences”, J Comput Biol 2000; 7(1-2):203-14.

RID: MF5DRSCF014

Database: Nucleotide collection (nt)

         29,783,440 sequences; 92,776,249,918 total letters

Query= 195 381:325

Length=235

                                                                 Score     E

Sequences producing significant alignments: (Bits) Value

gb|KM055065.1| Notopygos caribea isolate PAN344 18S ribosomal… 75.0 5e-10

gb|KM055064.1| Notopygos caribea isolate PAN343 18S ribosomal… 75.0 5e-10

gb|KM055063.1| Notopygos sp. Vanuatu voucher UF:Annelida399 1… 75.0 5e-10

gb|KM055062.1| Notopygos ornata voucher ECOSUR:OH-P0222 18S r… 75.0 5e-10

gb|KM055061.1| Notopygos ornata voucher ECOSUR:OH-P0221 18S r… 75.0 5e-10

gb|KM055059.1| Notopygos ornata voucher SIO:BIC:A5402 18S rib… 75.0 5e-10

gb|KM055058.1| Notopygos ornata voucher SIO:BIC:A5401 18S rib… 75.0 5e-10

gb|KM055057.1| Notopygos ornata voucher SIO:BIC:A5400 18S rib… 75.0 5e-10

gb|KM055056.1| Notopygos ornata voucher SIO:BIC:A5399 18S rib… 75.0 5e-10

gb|KM055055.1| Notopygos kekooa voucher SIO:BIC:A2274 18S rib… 75.0 5e-10

gb|KM055054.1| Notopygos mitsukurii voucher SIO:BIC:A2463 18S… 75.0 5e-10

gb|KM055053.1| Notopygos mitsukurii voucher SIO:BIC:A2462 18S… 75.0 5e-10

gb|KM055052.1| Notopygos caribea isolate BEL111 18S ribosomal… 75.0 5e-10

gb|KM055051.1| Archinome jasoni voucher SIO:BIC:A2315 18S rib… 75.0 5e-10

gb|KM055050.1| Archinome jasoni voucher SIO:BIC:A2375 18S rib… 75.0 5e-10

gb|KM055049.1| Archinome tethyana voucher SIO:BIC:A2874 18S r… 75.0 5e-10

gb|KM055048.1| Archinome levinae voucher SIO:BIC:A1482 18S ri… 75.0 5e-10

gb|KP759769.1| Babylonia spirata isolate KMCPGSZ04 18S riboso… 75.0 5e-10

dbj|AB914671.1| Aiteng sp. YK-2014 gene for 18S rRNA, partial… 75.0 5e-10

gb|KJ855075.1| Oxydromus humesi 18S ribosomal RNA gene, parti… 75.0 5e-10

gb|KP143043.1| Uncultured eukaryote clone G1029.0064A64 18S r… 75.0 5e-10

gb|KP143042.1| Uncultured eukaryote clone G1029.0022A22 18S r… 75.0 5e-10

gb|KP143014.1| Uncultured eukaryote clone G1029.0058A58 18S r… 75.0 5e-10

gb|KP143013.1| Uncultured eukaryote clone G1029.0042A42 18S r… 75.0 5e-10

gb|KP143012.1| Uncultured eukaryote clone G1029.0011A11 18S r… 75.0 5e-10

gb|JF913969.2| Syllis armillaris 18S ribosomal RNA gene, part… 75.0 5e-10

gb|JF903669.2| Syllis punctulata 18S ribosomal RNA gene, part… 75.0 5e-10

gb|JF903668.2| Syllis prolifera voucher MNCNM16.01/13286 clon… 75.0 5e-10

gb|JF903667.2| Syllis prolifera voucher MNCNM16.01/13285 clon… 75.0 5e-10

gb|JF903664.2| Syllis variegata voucher AMW.37720 18S ribosom… 75.0 5e-10

gb|JF903655.2| Syllis cf. variegata MTA-2011 18S ribosomal RN… 75.0 5e-10

gb|JF903615.2| Odontosyllis australiensis voucher AMW.37709 1… 75.0 5e-10

gb|JF903610.2| Haplosyllis sp. 3 MTA-2011 voucher MNCNM16.01/… 75.0 5e-10

gb|KP335097.1| Cernuella sp. ET3 18S ribosomal RNA gene, part… 75.0 5e-10

gb|KP335095.1| Xeropicta derbentina isolate EV1 18S ribosomal… 75.0 5e-10

gb|KM460896.1| Crassostrea virginica isolate Cv_A3 small subu… 75.0 5e-10

gb|KM460895.1| Crassostrea virginica isolate Cv_A2 small subu… 75.0 5e-10

gb|KM460894.1| Crassostrea virginica isolate Cv_A1 small subu… 75.0 5e-10

gb|KM460893.1| Hyotissa hyotis isolate Hh_J3 small subunit ri… 75.0 5e-10

gb|KM460892.1| Hyotissa hyotis isolate Hh_J2 small subunit ri… 75.0 5e-10

gb|KM460891.1| Hyotissa hyotis isolate Hh_J1 small subunit ri… 75.0 5e-10

gb|KM460890.1| Saccostrea kegaki isolate Sk_J3 small subunit … 75.0 5e-10

gb|KM460889.1| Saccostrea kegaki isolate Sk_J2 small subunit … 75.0 5e-10

gb|KM460888.1| Saccostrea kegaki isolate Sk_J1 small subunit … 75.0 5e-10

gb|KM460887.1| Ostrea circumpicta isolate Oc_J3 small subunit… 75.0 5e-10

gb|KM460886.1| Ostrea circumpicta isolate Oc_J2 small subunit… 75.0 5e-10

gb|KM460885.1| Ostrea circumpicta isolate Oc_J1 small subunit… 75.0 5e-10

gb|KM460884.1| Ostrea denselamellosa isolate Od_S3 small subu… 75.0 5e-10

gb|KM460883.1| Ostrea denselamellosa isolate Od_S2 small subu… 75.0 5e-10

gb|KM460882.1| Ostrea denselamellosa isolate Od_S1 small subu… 75.0 5e-10

gb|KM460881.1| Crassostrea nippona isolate Cn_E3 small subuni… 75.0 5e-10

gb|KM460880.1| Crassostrea nippona isolate Cn_E2 small subuni… 75.0 5e-10

gb|KM460879.1| Crassostrea nippona isolate Cn_E1 small subuni… 75.0 5e-10

gb|KM460878.1| Crassostrea gigas isolate Cg_S3 small subunit … 75.0 5e-10

gb|KM460877.1| Crassostrea gigas isolate Cg_S2 small subunit … 75.0 5e-10

gb|KM460876.1| Crassostrea gigas isolate Cg_S1 small subunit … 75.0 5e-10

gb|KM460875.1| Crassostrea ariakensis isolate Ca_S3 small sub… 75.0 5e-10

gb|KM460874.1| Crassostrea ariakensis isolate Ca_S2 small sub… 75.0 5e-10

gb|KM460873.1| Crassostrea ariakensis isolate Ca_S1 small sub… 75.0 5e-10

gb|KM083602.1| Hummondasys jamaicensis isolate MS21 18S ribos… 75.0 5e-10

dbj|AB967997.1| Ochetostoma erythrogrammon gene for 18S ribos… 75.0 5e-10

dbj|AB967996.1| Listriolobus sorbillans gene for 18S ribosoma… 75.0 5e-10

dbj|AB967995.1| Listriolobus sorbillans gene for 18S ribosoma… 75.0 5e-10

dbj|AB967994.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967993.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967992.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967991.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967990.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967989.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967988.1| Ikedosoma gogoshimense gene for 18S ribosomal… 75.0 5e-10

dbj|AB967987.1| Ikedosoma elegans gene for 18S ribosomal RNA,… 75.0 5e-10

dbj|AB967986.1| Ikedosoma elegans gene for 18S ribosomal RNA,… 75.0 5e-10

dbj|AB967985.1| Ikedosoma elegans gene for 18S ribosomal RNA,… 75.0 5e-10

gb|KP702201.1| Enchytraeus sp. Driefontein B 18S ribosomal RN… 75.0 5e-10

gb|KM875509.1| Montenegrospeum bogici 18S ribosomal RNA gene,… 75.0 5e-10

gb|KP171533.1| Physella acuta 18S ribosomal RNA gene, partial… 75.0 5e-10

gb|KM289064.1| Urodasys spirostylis isolate 9i 18S ribosomal … 75.0 5e-10

gb|KM289063.1| Urodasys calicostylis isolate 186a 18S ribosom… 75.0 5e-10

gb|KM289062.1| Urodasys calicostylis isolate 96a 18S ribosoma… 75.0 5e-10

gb|KM289061.1| Urodasys calicostylis isolate 138a 18S ribosom… 75.0 5e-10

gb|KM289060.1| Urodasys sp. 11i 18S ribosomal RNA gene, parti… 75.0 5e-10

gb|KM289059.1| Urodasys nodostylis isolate BLZ1081 18S riboso… 75.0 5e-10

gb|KM289058.1| Urodasys poculostylis isolate 137a 18S ribosom… 75.0 5e-10

gb|KM289057.1| Urodasys poculostylis isolate 95a 18S ribosoma… 75.0 5e-10

gb|KM289056.1| Urodasys poculostylis isolate 116a 18S ribosom… 75.0 5e-10

gb|KM289055.1| Urodasys viviparus isolate 199c 18S ribosomal … 75.0 5e-10

gb|KM289054.1| Urodasys viviparus isolate 5h 18S ribosomal RN… 75.0 5e-10

gb|KM289051.1| Urodasys viviparus isolate 190c 18S ribosomal … 75.0 5e-10

gb|KM289050.1| Urodasys viviparus isolate 64d 18S ribosomal R… 75.0 5e-10

gb|KM289049.1| Urodasys viviparus isolate 43e 18S ribosomal R… 75.0 5e-10

gb|KM289044.1| Urodasys viviparus isolate 1h 18S ribosomal RN… 75.0 5e-10

gb|KM289043.1| Urodasys viviparus isolate 192c 18S ribosomal … 75.0 5e-10

gb|KM289041.1| Urodasys viviparus isolate 67e 18S ribosomal R… 75.0 5e-10

gb|KM289040.1| Urodasys viviparus isolate 30e 18S ribosomal R… 75.0 5e-10

gb|KM289039.1| Urodasys viviparus isolate 19c 18S ribosomal R… 75.0 5e-10

gb|KM289037.1| Urodasys viviparus isolate 163c 18S ribosomal … 75.0 5e-10

gb|KM289036.1| Urodasys viviparus isolate 12c 18S ribosomal R… 75.0 5e-10

gb|KM289035.1| Urodasys viviparus isolate 114c 18S ribosomal … 75.0 5e-10

gb|KJ753898.1| Inanidrilus leukodermatus isolate CE901 18S ri… 75.0 5e-10

gb|KJ753897.1| Gianius aquaedulcis isolate CE654 18S ribosoma… 75.0 5e-10

ALIGNMENTS

gb|KM055065.1| Notopygos caribea isolate PAN344 18S ribosomal RNA gene, partial

sequence

Length=1726

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055064.1| Notopygos caribea isolate PAN343 18S ribosomal RNA gene, partial

sequence

Length=1726

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055063.1| Notopygos sp. Vanuatu voucher UF:Annelida399 18S ribosomal RNA

gene, partial sequence

Length=1726

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055062.1| Notopygos ornata voucher ECOSUR:OH-P0222 18S ribosomal RNA gene,

partial sequence

Length=1726

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055061.1| Notopygos ornata voucher ECOSUR:OH-P0221 18S ribosomal RNA gene,

partial sequence

Length=1726

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055059.1| Notopygos ornata voucher SIO:BIC:A5402 18S ribosomal RNA gene,

partial sequence

Length=1717

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055058.1| Notopygos ornata voucher SIO:BIC:A5401 18S ribosomal RNA gene,

partial sequence

Length=1700

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055057.1| Notopygos ornata voucher SIO:BIC:A5400 18S ribosomal RNA gene,

partial sequence

Length=1726

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055056.1| Notopygos ornata voucher SIO:BIC:A5399 18S ribosomal RNA gene,

partial sequence

Length=1696

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

gb|KM055055.1| Notopygos kekooa voucher SIO:BIC:A2274 18S ribosomal RNA gene,

partial sequence

Length=1710

Score = 75.0 bits (40), Expect = 5e-10

Identities = 40/40 (100%), Gaps = 0/40 (0%)

Strand=Plus/Minus

Query 1 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAAtc 40

          ||||||||||||||||||||||||||||||||||||||||

Sbjct 356 TGGATGTGGTAGCCGTTTCTCATGCTCCCTCTCCGGAATC 317

You could leave a comment if you were logged in.
contributors/team_5/10_blast.txt · Last modified: 2015/09/02 09:23 by ceisenhart