**This is an old revision of the document!** ----
======Tasks====== Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary. |Task| Assignee | Status | Notes| | Plot contig size vs total genome size for assemblies | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | | Analyze SeqPrep results | | | | | UCSC Genome browser hub | Eisenhart | Complete | Discovar De novo and SOAP have data up, very early phase | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | | Analyze new data (preqc) | Richardson | In progress | | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | Preqc on new mate pair SW041 SW042| Saremi | Completed | | | Update the wiki to include mate pair meta data | Eisenhart | completed | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | Map lucigen mates against scaffolds | Dudek | completed | See sam file at /campusdata/ndudek/mapping_lucigen/5kb_plus_discovar/IJS8_mates_vs_discovar_bigContigs_5000.sam | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| |SSpace on discovar de novo assembly fasta | Eisenhart | In process | Under review, results will be posted soon | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion |