User Tools

Site Tools


archive:specific_task

Tasks

Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary.

Task Assignee Status Notes
Install Maker Houser Complete Maker is installed, see information here
Assemble repeat genome with RepArkTeam 1In progressCharles has started a test run using the original Hiseq and Miseq reads
Run GapCloser on SOAP denovo assemblyCharlesIn progress Use SOAP denovo's external gap closer. Chose a reasonable name for new assembly.
Find virus contigs and use PRICE to expand to full viruses Cole,jolespin jolespin virus assembly progress can be accessed at jolespin_virus
Mate-pair adapter and linker removal
Measuring insert size for each mate-pair library unassigned
Making Seqprep, adapter removed, end-trimmed library files unassigned
Blast long contigs and analyze results unassigned Check the browser for the 30 longest contigs from each group with contigs
Find genes in the mitochondrial genome unassigned The genome is on the browser, find it here https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser
Use PRICE to get mitochondrial genome as single contig Natasha Dudek?
Plot contig size vs total genome size for assemblies unassigned
Ask UCSF about the discrepancy in the numbers of reads unassigned I don't see any discrepancy in the number of reads, perhaps this can be removed?
Fastqc/kmergenie on SeqPrepped data unassigned waiting on previous steps
End trim SeqPrepped data Hussain
Error correct SeqPrepped data McGovern waiting on previous step
Error Correction new data McGovern (Musket) In progress
Install bowtie Chaves In progress /campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)
UCSC Genome browser hub Eisenhart Complete https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser
Plot contig size histogram for current assembly (SOAPdenovo2 results) Markello Complete
Plot scaffold size histogram for current assembly (SOAPdenovo2 results) Markello Complete
Find cost of creating a tagmentase library Dudek ~$50
Merge/trim new data (SeqPrep) Hussain Completed See wiki page for each data set for details
Analyze new data (preqc) Richardson Completed See wiki page for each data set for details
Preqc on new mate pair SW041 SW042 Saremi Completed
Update the wiki to include mate pair meta data Eisenhart completed
Install CEGMA dependencies Markello Completed Issue discovered: glib required for complete installation of latest version of genewise (CEGMA dependency) on head node, will use current installation of genewise.
Create a file containing contigs longer than 5kb Eisenhart completed file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa
Plot scaffold size histogram for current assembly (Discovar de novo results) Dudek Completed 10% and the new UCSF 50% are up on the discovar team page
Map lucigen mates against scaffolds Dudek completed See sam file at /campusdata/ndudek/mapping_lucigen/5kb_plus_discovar/IJS8_mates_vs_discovar_bigContigs_5000.sam
Analyze new data (fastqc) Saremi Completed /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc
Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq) Chaves & Dudek Completed /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)
SSpace on discovar de novo assembly fasta Eisenhart Complete Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile
Map reads against 2012 mitochondrion assembly Dudek Completed for UCSF SW018 and SW019 reads I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion
You could leave a comment if you were logged in.
archive/specific_task.txt · Last modified: 2015/08/03 20:32 by 68.180.228.52