**This is an old revision of the document!** ----
======Tasks====== Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary. |Task| Assignee | Status | Notes| | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb | | Plot contig size vs total genome size for assemblies | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | Analyze new data (preqc) | Richardson | In progress | | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | Analyze SeqPrep results | | | | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires |