archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision | ||
|
archive:specific_task [2015/05/08 18:49] ndudek |
archive:specific_task [2015/08/04 03:32] (current) 68.180.228.52 ↷ Links adapted because of a move operation |
||
|---|---|---|---|
| Line 1: | Line 1: | ||
| - | |Name|Task|Notes| | + | ======Tasks====== |
| - | | Dudek | Map lucigen mates against scaffolds to estimate insert size | | | + | Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary. |
| - | | | Plot contig size vs total genome size for assemblies | | | + | |
| - | | Dudek | Find cost of creating a tagmentase library| ~$50 | | + | |
| - | | | Ask UCSF about the discrepancy in the numbers of reads | | | + | |
| + | |Task| Assignee | Status | Notes| | ||
| + | |Install Maker| Houser | Complete | Maker is installed, see information [[archive:maker|here]] | | ||
| + | |Assemble repeat genome with RepArk|Team 1|In progress|Charles has started a test run using the original Hiseq and Miseq reads| | ||
| + | |Run GapCloser on SOAP denovo assembly|Charles|In progress| Use SOAP denovo's external gap closer. Chose a reasonable name for new assembly. | | ||
| + | |Find virus contigs and use PRICE to expand to full viruses | Cole,jolespin | | jolespin virus assembly progress can be accessed at [[archive:jolespin_virus]]| | ||
| + | | Mate-pair adapter and linker removal| | | | | ||
| + | | Measuring insert size for each mate-pair library | unassigned | | | | ||
| + | | Making Seqprep, adapter removed, end-trimmed library files | unassigned | | | | ||
| + | | Blast long contigs and analyze results | unassigned| | Check the browser for the 30 longest contigs from each group with contigs| | ||
| + | | Find genes in the mitochondrial genome | unassigned | | The genome is on the browser, find it here https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | | ||
| + | | Use PRICE to get mitochondrial genome as single contig | Natasha Dudek? | | | | ||
| + | | Plot contig size vs total genome size for assemblies | unassigned | | | | ||
| + | | Ask UCSF about the discrepancy in the numbers of reads | unassigned | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | | ||
| + | | Fastqc/kmergenie on SeqPrepped data | unassigned | waiting on previous steps | | | ||
| + | | End trim SeqPrepped data | Hussain | | | | ||
| + | | Error correct SeqPrepped data | McGovern | waiting on previous step | | | ||
| + | | Error Correction new data| McGovern (Musket) | In progress | | | ||
| + | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | ||
| + | | UCSC Genome browser hub | Eisenhart | Complete | https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | | ||
| + | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
| + | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
| + | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| + | | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | | ||
| + | | Analyze new data (preqc) | Richardson | Completed | See wiki page for each data set for details | | ||
| + | | Preqc on new mate pair SW041 SW042| Saremi | Completed | | | ||
| + | | Update the wiki to include mate pair meta data | Eisenhart | completed | | ||
| + | | Install CEGMA dependencies | Markello | Completed | Issue discovered: glib required for complete installation of latest version of genewise (CEGMA dependency) on head node, will use current installation of genewise. | | ||
| + | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | ||
| + | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | ||
| + | | Map lucigen mates against scaffolds | Dudek | completed | See sam file at /campusdata/ndudek/mapping_lucigen/5kb_plus_discovar/IJS8_mates_vs_discovar_bigContigs_5000.sam | | ||
| + | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| + | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| + | |SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile | | ||
| + | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | | ||
archive/specific_task.1431110954.txt.gz · Last modified: 2015/05/08 18:49 by ndudek
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
