Differences

This shows you the differences between two versions of the page.

--- archive:specific_task [2015/05/15 16:42]
ceisenhart
+++ archive:specific_task [2015/06/01 19:22]
jdhouser
@@ Line 3: / Line 3: @@
 |Task| Assignee | Status | Notes|
-| Plot contig size vs total genome size for assemblies | | | |
+|Install Maker| Houser | In progress | Working on getting dependencies installed |
-| Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed?  |
+|Assemble repeat genome with RepArk|Team 1|In progress|Charles has started a test run using the original Hiseq and Miseq reads|
-| Analyze SeqPrep results | | | |
+|Run GapCloser on SOAP denovo assembly|Charles|In progress| Use SOAP denovo's external gap closer. Chose a reasonable name for new assembly. |
-| UCSC Genome browser hub | Eisenhart | Complete | Discovar De novo and SOAP have data up, very early phase |
+|Find virus contigs and use PRICE to expand to full viruses | Cole,jolespin | | jolespin virus assembly progress can be accessed at [[jolespin_virus]]|
-| Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
+| Mate-pair adapter and linker removal|  | | |
-| Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
+| Measuring insert size for each mate-pair library | unassigned | | |
+| Making Seqprep, adapter removed, end-trimmed library files | unassigned | | |
+| Blast long contigs and analyze results | unassigned| | Check the browser for the 30 longest contigs from each group with contigs|
+| Find genes in the mitochondrial genome | unassigned | | The genome is on the browser, find it here https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser |
+| Use PRICE to get mitochondrial genome as single contig | Natasha Dudek? | | |
+| Plot contig size vs total genome size for assemblies | unassigned | | |
+| Ask UCSF about the discrepancy in the numbers of reads | unassigned | | I don't see any discrepancy in the number of reads, perhaps this can be removed?  |
+| Fastqc/kmergenie on SeqPrepped data | unassigned | waiting on previous steps | |
+| End trim SeqPrepped data | Hussain | | |
+| Error correct SeqPrepped data | McGovern | waiting on previous step | |
+| Error Correction new data| McGovern (Musket) | In progress |  |
+| Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)|
+| UCSC Genome browser hub | Eisenhart | Complete | https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser |
+| Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | |
+| Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | |
 | Find cost of creating a tagmentase library| Dudek | | ~$50 |
 | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details |
-| Analyze new data (preqc) | Richardson | In progress | |
+| Analyze new data (preqc) | Richardson | Completed | See wiki page for each data set for details |
-| Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... |
-| Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)|
 | Preqc on new mate pair SW041 SW042| Saremi | Completed | |
 | Update the wiki to include mate pair meta data | Eisenhart | completed |
-| Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires |
+| Install CEGMA dependencies | Markello | Completed | Issue discovered: glib required for complete installation of latest version of genewise (CEGMA dependency) on head node, will use current installation of genewise. |
 | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa |
 | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page |
@@ Line 22: / Line 34: @@
 | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc |
 | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
-|SSpace on discovar de novo assembly fasta | Eisenhart | In process | Under review, results will be posted soon |
+|SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile |
 | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion |

Banana Slug Genomics

User Tools

Site Tools

Differences

Page Tools