User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/15 16:42]
ceisenhart
archive:specific_task [2015/05/15 17:27]
ceisenhart
Line 6: Line 6:
 | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? ​ |  | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? ​ | 
 | Analyze SeqPrep results | | | |  | Analyze SeqPrep results | | | | 
-| UCSC Genome browser hub | Eisenhart | Complete | Discovar De novo and SOAP have data up, very early phase | +| UCSC Genome browser hub | Eisenhart | Complete | Discovar De novo and SOAP have data up, very early phase, make a custom hub with this link, http://​hgwdev-ceisenhart.cse.ucsc.edu/​~ceisenhart/​hubs/​bananaSlug/​hub.txt ​
 | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
 | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
Line 22: Line 22:
 | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​ | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​
 | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
-|SSpace on discovar de novo assembly fasta | Eisenhart | In process ​Under review, results will be posted ​soon +|SSpace on discovar de novo assembly fasta | Eisenhart | Complete ​Results are posted ​here , https://​banana-slug.soe.ucsc.edu/​team_5_page:​sspacesummaryfile ​
 | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /​campusdata/​BME235/​mitochondrion | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /​campusdata/​BME235/​mitochondrion |
  
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52