archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision | Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/15 16:42] ceisenhart |
archive:specific_task [2015/05/15 17:25] ceisenhart |
||
|---|---|---|---|
| Line 22: | Line 22: | ||
| | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| - | |SSpace on discovar de novo assembly fasta | Eisenhart | In process | Under review, results will be posted soon | | + | |SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile | |
| | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | | ||
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
