archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/10 07:08] charles |
archive:specific_task [2015/05/16 02:19] ceisenhart |
||
|---|---|---|---|
| Line 3: | Line 3: | ||
| |Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
| - | | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb | | + | | Blast long contigs and analyze results | unassigned | | Check the browser for the 30 longest contigs | |
| - | | Plot contig size vs total genome size for assemblies | | | | | + | | Find genes in the mitochondrial genome | unassigned | | The genome is on the browser, find it here https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | |
| - | | Ask UCSF about the discrepancy in the numbers of reads | | | | | + | | Plot contig size vs total genome size for assemblies | unassigned | | | |
| + | | Ask UCSF about the discrepancy in the numbers of reads | unassigned | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | | ||
| + | | Analyze SeqPrep results | | | | | ||
| + | | UCSC Genome browser hub | Eisenhart | Complete | https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | | ||
| + | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
| + | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
| | Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| - | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | + | | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | |
| | Analyze new data (preqc) | Richardson | In progress | | | | Analyze new data (preqc) | Richardson | In progress | | | ||
| - | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| - | | Analyze SeqPrep results | | | | | ||
| | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | ||
| + | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | ||
| + | | Preqc on new mate pair SW041 SW042| Saremi | Completed | | | ||
| + | | Update the wiki to include mate pair meta data | Eisenhart | completed | | ||
| + | | Install CEGMA dependencies | Markello | In progress | Issue discovered: glib required for complete installation of genewise (CEGMA dependency), will use current installation of genewise. | | ||
| + | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | ||
| + | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | ||
| + | | Map lucigen mates against scaffolds | Dudek | completed | See sam file at /campusdata/ndudek/mapping_lucigen/5kb_plus_discovar/IJS8_mates_vs_discovar_bigContigs_5000.sam | | ||
| + | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| - | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | + | |SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile | |
| - | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | + | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | |
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
