User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/08 19:04]
ndudek
archive:specific_task [2015/05/10 07:08]
charles
Line 1: Line 1:
-|Name|Task|Notes| +======Tasks====== 
-| | Map lucigen mates against scaffolds ​to estimate insert size | | +Use this page to create and claim tasks that are relevant ​to the whole class. Completed tasks should be moved to the bottom ​of the list. Feel free to break tasks down into smaller subparts if necessary. ​
-| | Plot contig size vs total genome size for assemblies | | +
-| Dudek | Find cost of creating a tagmentase library| ~$50 | +
-| | Ask UCSF about the discrepancy in the numbers ​of reads | | +
- +
  
 +|Task| Assignee | Status | Notes|
 +| Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb |
 +| Plot contig size vs total genome size for assemblies | | | |
 +| Ask UCSF about the discrepancy in the numbers of reads | | | | 
 +| Find cost of creating a tagmentase library| Dudek | | ~$50 |
 +| Merge/trim new data (SeqPrep) | Hussain | in progress | |
 +| Analyze new data (preqc) | Richardson | In progress | |  ​
 +| Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​
 +| Analyze SeqPrep results | | | | 
 +| Error Correction new data| McGovern (Musket) & Richardson (BLESS/​racer) | In progress | These programs have not yet been run succesfully... |
 +| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
 +| Install bowtie | Chaves | Completed |/​campusdata/​gchaves/​Bowtie/​bowtie2-2.2.5|
 +| Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires |
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52