This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/14 18:47] ndudek |
archive:specific_task [2015/07/18 21:21] 65.19.138.34 ↷ Links adapted because of a move operation |
||
---|---|---|---|
Line 3: | Line 3: | ||
|Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
- | | Plot contig size vs total genome size for assemblies | | | | | + | |Install Maker| Houser | Complete | Maker is installed, see information [[maker|here]] | |
- | | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | | + | |Assemble repeat genome with RepArk|Team 1|In progress|Charles has started a test run using the original Hiseq and Miseq reads| |
- | | Analyze SeqPrep results | | | | | + | |Run GapCloser on SOAP denovo assembly|Charles|In progress| Use SOAP denovo's external gap closer. Chose a reasonable name for new assembly. | |
- | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | + | |Find virus contigs and use PRICE to expand to full viruses | Cole,jolespin | | jolespin virus assembly progress can be accessed at [[archive:jolespin_virus]]| |
- | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | + | | Mate-pair adapter and linker removal| | | | |
+ | | Measuring insert size for each mate-pair library | unassigned | | | | ||
+ | | Making Seqprep, adapter removed, end-trimmed library files | unassigned | | | | ||
+ | | Blast long contigs and analyze results | unassigned| | Check the browser for the 30 longest contigs from each group with contigs| | ||
+ | | Find genes in the mitochondrial genome | unassigned | | The genome is on the browser, find it here https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | | ||
+ | | Use PRICE to get mitochondrial genome as single contig | Natasha Dudek? | | | | ||
+ | | Plot contig size vs total genome size for assemblies | unassigned | | | | ||
+ | | Ask UCSF about the discrepancy in the numbers of reads | unassigned | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | | ||
+ | | Fastqc/kmergenie on SeqPrepped data | unassigned | waiting on previous steps | | | ||
+ | | End trim SeqPrepped data | Hussain | | | | ||
+ | | Error correct SeqPrepped data | McGovern | waiting on previous step | | | ||
+ | | Error Correction new data| McGovern (Musket) | In progress | | | ||
+ | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | ||
+ | | UCSC Genome browser hub | Eisenhart | Complete | https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | | ||
+ | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
+ | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
| Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | | | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | | ||
- | | Analyze new data (preqc) | Richardson | In progress | | | + | | Analyze new data (preqc) | Richardson | Completed | See wiki page for each data set for details | |
- | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | + | |
- | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | + | |
| Preqc on new mate pair SW041 SW042| Saremi | Completed | | | | Preqc on new mate pair SW041 SW042| Saremi | Completed | | | ||
| Update the wiki to include mate pair meta data | Eisenhart | completed | | | Update the wiki to include mate pair meta data | Eisenhart | completed | | ||
- | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | + | | Install CEGMA dependencies | Markello | Completed | Issue discovered: glib required for complete installation of latest version of genewise (CEGMA dependency) on head node, will use current installation of genewise. | |
| Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | ||
| Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | ||
Line 21: | Line 34: | ||
| Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
- | |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | + | |SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile | |
+ | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | | ||