archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision | Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/14 18:47] ndudek |
archive:specific_task [2015/05/15 01:04] ndudek |
||
|---|---|---|---|
| Line 22: | Line 22: | ||
| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | ||
| + | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | | ||
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
