User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/13 06:15]
nsaremi
archive:specific_task [2015/05/15 01:04]
ndudek
Line 9: Line 9:
 | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
 | Find cost of creating a tagmentase library| Dudek | | ~$50 | | Find cost of creating a tagmentase library| Dudek | | ~$50 |
-| Merge/trim new data (SeqPrep) | Hussain | in progress ​| |+| Merge/trim new data (SeqPrep) | Hussain | Completed ​See wiki page for each data set for details ​|
 | Analyze new data (preqc) | Richardson | In progress | |  ​ | Analyze new data (preqc) | Richardson | In progress | |  ​
 | Error Correction new data| McGovern (Musket) & Richardson (BLESS/​racer) | In progress | These programs have not yet been run succesfully... | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/​racer) | In progress | These programs have not yet been run succesfully... |
Line 18: Line 18:
 | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF50%run/​bigContigs.fa | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF50%run/​bigContigs.fa |
 | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page |
-| Map lucigen mates against scaffolds ​to estimate insert size | Dudek | in progress ​ |+| Map lucigen mates against scaffolds | Dudek | completed ​See sam file at /​campusdata/​ndudek/​mapping_lucigen/​5kb_plus_discovar/​IJS8_mates_vs_discovar_bigContigs_5000.sam ​|
 | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​ | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​
 | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
 |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued |  |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | 
 +| Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /​campusdata/​BME235/​mitochondrion |
  
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52