archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/13 06:15] nsaremi |
archive:specific_task [2015/05/14 18:47] ndudek |
||
|---|---|---|---|
| Line 9: | Line 9: | ||
| | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
| | Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| - | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | + | | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | |
| | Analyze new data (preqc) | Richardson | In progress | | | | Analyze new data (preqc) | Richardson | In progress | | | ||
| | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | ||
| Line 18: | Line 18: | ||
| | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | ||
| | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | ||
| - | | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | | | + | | Map lucigen mates against scaffolds | Dudek | completed | See sam file at /campusdata/ndudek/mapping_lucigen/5kb_plus_discovar/IJS8_mates_vs_discovar_bigContigs_5000.sam | |
| | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | ||
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
