User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/13 05:00]
ndudek
archive:specific_task [2015/05/14 18:47]
ndudek
Line 6: Line 6:
 | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? ​ |  | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? ​ | 
 | Analyze SeqPrep results | | | |  | Analyze SeqPrep results | | | | 
-| Preqc on new mate pair SW041 SW042| Saremi | In progress | | 
 | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
 | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
 | Find cost of creating a tagmentase library| Dudek | | ~$50 | | Find cost of creating a tagmentase library| Dudek | | ~$50 |
-| Merge/trim new data (SeqPrep) | Hussain | in progress ​| |+| Merge/trim new data (SeqPrep) | Hussain | Completed ​See wiki page for each data set for details ​|
 | Analyze new data (preqc) | Richardson | In progress | |  ​ | Analyze new data (preqc) | Richardson | In progress | |  ​
 | Error Correction new data| McGovern (Musket) & Richardson (BLESS/​racer) | In progress | These programs have not yet been run succesfully... | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/​racer) | In progress | These programs have not yet been run succesfully... |
 | Install bowtie | Chaves | In progress |/​campusdata/​gchaves/​Bowtie/​bowtie2-2.2.5 (Not yet running successfully)| | Install bowtie | Chaves | In progress |/​campusdata/​gchaves/​Bowtie/​bowtie2-2.2.5 (Not yet running successfully)|
 +| Preqc on new mate pair SW041 SW042| Saremi | Completed | |
 | Update the wiki to include mate pair meta data | Eisenhart | completed |  | Update the wiki to include mate pair meta data | Eisenhart | completed | 
 | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires |
 | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF50%run/​bigContigs.fa | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF50%run/​bigContigs.fa |
 | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page |
-| Map lucigen mates against scaffolds ​to estimate insert size | Dudek | in progress ​ |+| Map lucigen mates against scaffolds | Dudek | completed ​See sam file at /​campusdata/​ndudek/​mapping_lucigen/​5kb_plus_discovar/​IJS8_mates_vs_discovar_bigContigs_5000.sam ​|
 | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​ | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​
 | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
 |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued |  |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | 
  
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52