This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/12 03:04] nsaremi |
archive:specific_task [2015/05/12 16:34] ceisenhart |
||
---|---|---|---|
Line 4: | Line 4: | ||
|Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
| Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
- | | Ask UCSF about the discrepancy in the numbers of reads | | | | | + | | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | |
| Analyze SeqPrep results | | | | | | Analyze SeqPrep results | | | | | ||
| Preqc on new mate pair SW041 SW042| | | | | | Preqc on new mate pair SW041 SW042| | | | | ||
Line 18: | Line 18: | ||
| Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
+ | |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | ||