User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/12 03:02]
nsaremi
archive:specific_task [2015/05/12 16:34]
ceisenhart
Line 3: Line 3:
  
 |Task| Assignee | Status | Notes| |Task| Assignee | Status | Notes|
-| Preqc con new mate pair SW041 SW042| | | | 
 | Plot contig size vs total genome size for assemblies | | | | | Plot contig size vs total genome size for assemblies | | | |
-| Ask UCSF about the discrepancy in the numbers of reads | | | | +| Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed?  ​
 | Analyze SeqPrep results | | | |  | Analyze SeqPrep results | | | | 
 +| Preqc on new mate pair SW041 SW042| | | |
 | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
 | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
Line 18: Line 18:
 | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​ | Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​
 | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
 +|SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | 
  
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52