Differences

This shows you the differences between two versions of the page.

--- archive:specific_task [2015/05/11 22:04]
sihussai moved completed tasks down, unassigned ones up
+++ archive:specific_task [2015/05/12 16:34]
ceisenhart
@@ Line 4: / Line 4: @@
 |Task| Assignee | Status | Notes|
 | Plot contig size vs total genome size for assemblies | | | |
-| Ask UCSF about the discrepancy in the numbers of reads | | | |
+| Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed?  |
 | Analyze SeqPrep results | | | |
+| Preqc on new mate pair SW041 SW042| | | |
 | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
 | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | |
@@ Line 17: / Line 18: @@
 | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc |
 | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
+|SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued |

Banana Slug Genomics