archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision | Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/10 22:07] ndudek |
archive:specific_task [2015/05/11 04:06] gepoliano |
||
|---|---|---|---|
| Line 15: | Line 15: | ||
| | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | ||
| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| - | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | + | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| |
| | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | ||
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
