archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/10 04:51] jennie |
archive:specific_task [2015/05/10 22:07] ndudek |
||
|---|---|---|---|
| Line 3: | Line 3: | ||
| |Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
| - | | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb | | + | | Map lucigen mates against scaffolds to estimate insert size | Dudek | Completed | There seem to be technical issues with the lucigen mate pair reads. Average read length is 40bp and average insert size is ~220bp, compared to an expected read length of 300bp and insert size over 1kb. Also, I spoke with Brendan and there is new mate-pair data coming soon (expected the week of May 10th). | |
| | Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
| + | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
| + | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
| | Ask UCSF about the discrepancy in the numbers of reads | | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
| | Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| Line 14: | Line 16: | ||
| | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | ||
| + | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | ||
archive/specific_task.txt ยท Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
