This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/09 20:23] jennie |
archive:specific_task [2015/05/10 04:51] jennie |
||
---|---|---|---|
Line 8: | Line 8: | ||
| Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| Merge/trim new data (SeqPrep) | Hussain | in progress | | | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | ||
- | | Analyze new data (preqc) | | | | | + | | Analyze new data (preqc) | Richardson | In progress | | |
| Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
| Analyze SeqPrep results | | | | | | Analyze SeqPrep results | | | | | ||
- | | Error Correction new data| McGovern (Musket) & Richardson (BLESS) | In Progress | We do not have either program running yet... | | + | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | |
- | | Alternate error correction tool | | | | | + | |
| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
| Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| |