Differences

This shows you the differences between two versions of the page.

--- archive:specific_task [2015/05/09 02:43]
ndudek
+++ archive:specific_task [2015/05/10 04:21]
jennie
@@ Line 8: / Line 8: @@
 | Find cost of creating a tagmentase library| Dudek | | ~$50 |
 | Merge/trim new data (SeqPrep) | Hussain | in progress | |
-| Analyze new data (preqc) | | | |
+| Analyze new data (preqc) | Richardson | In progress | |
 | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc |
 | Analyze SeqPrep results | | | |
-| Error Correction new data| | | |
+| Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... |
 | Alternate error correction tool  | | | |
-| Adapter trim new data (Skewer)  SW018 and SW019| Chaves| Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
+| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
 | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5|

Banana Slug Genomics