This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/09 00:27] gepoliano |
archive:specific_task [2015/05/09 03:22] ndudek |
||
---|---|---|---|
Line 3: | Line 3: | ||
|Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
- | | Map lucigen mates against scaffolds to estimate insert size | | | | | + | | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb | |
| Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
| Ask UCSF about the discrepancy in the numbers of reads | | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
Line 13: | Line 13: | ||
| Error Correction new data| | | | | | Error Correction new data| | | | | ||
| Alternate error correction tool | | | | | | Alternate error correction tool | | | | | ||
- | | Adapter trim new data (Skewer) **SW018 and SW019**| Chaves| Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | + | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| |
- | + | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + |