User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/08 23:07]
nsaremi
archive:specific_task [2015/05/15 01:04]
ndudek
Line 3: Line 3:
  
 |Task| Assignee | Status | Notes| |Task| Assignee | Status | Notes|
-| Map lucigen mates against scaffolds to estimate insert size | | | | 
 | Plot contig size vs total genome size for assemblies | | | | | Plot contig size vs total genome size for assemblies | | | |
-| Ask UCSF about the discrepancy in the numbers of reads | | | |  +| Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number ​of reads, perhaps this can be removed? ​ ​| ​
-| Find cost of creating a tagmentase library| Dudek | | ~$50 | +
-| Merge/trim new data (SeqPrep) | Hussain | in progress | | +
-| Preqc new data | | | |   +
-Fastqc new data | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​+
 | Analyze SeqPrep results | | | |  | Analyze SeqPrep results | | | | 
-| Error Correction new data| | | | +| Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | 
-Alternate error correction tool  ​| | | | +| Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | 
-Adapter trim new data| | | this will be in addition ​to the seqprep adapter removal ​+| Find cost of creating a tagmentase library| Dudek | | ~$50 | 
- +| Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | 
- +| Analyze new data (preqc) | Richardson | In progress | |   
- +| Error Correction new data| McGovern (Musket) & Richardson (BLESS/​racer) ​In progress ​These programs have not yet been run succesfully... ​
 +Install bowtie ​Chaves ​In progress ​|/​campusdata/​gchaves/​Bowtie/​bowtie2-2.2.5 (Not yet running successfully)
 +Preqc on new mate pair SW041 SW042| Saremi | Completed | | 
 +| Update the wiki to include mate pair meta data | Eisenhart ​completed ​ 
 +| Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | 
 +| Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF50%run/​bigContigs.fa | 
 +| Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page 
 +| Map lucigen mates against scaffolds | Dudek | completed | See sam file at /​campusdata/​ndudek/​mapping_lucigen/​5kb_plus_discovar/​IJS8_mates_vs_discovar_bigContigs_5000.sam | 
 +| Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​ 
 +| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| 
 +|SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued |  
 +| Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /​campusdata/​BME235/​mitochondrion |
  
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52