Differences

This shows you the differences between two versions of the page.

--- archive:specific_task [2015/05/08 22:15]
nsaremi
+++ archive:specific_task [2015/05/09 20:23]
jennie
@@ Line 3: / Line 3: @@
 |Task| Assignee | Status | Notes|
-| Map lucigen mates against scaffolds to estimate insert size | | | |
+| Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb |
 | Plot contig size vs total genome size for assemblies | | | |
 | Ask UCSF about the discrepancy in the numbers of reads | | | |
@@ Line 11: / Line 11: @@
 | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc |
 | Analyze SeqPrep results | | | |
-| Error Correction new data| | | |
+| Error Correction new data| McGovern (Musket) & Richardson (BLESS) | In Progress | We do not have either program running yet... |
 | Alternate error correction tool  | | | |
-| Adapter trim new data| | | this will be in addition to the seqprep adapter removal |
+| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
+| Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5|

Banana Slug Genomics