archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/08 22:15] nsaremi |
archive:specific_task [2015/05/09 02:43] ndudek |
||
|---|---|---|---|
| Line 3: | Line 3: | ||
| |Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
| - | | Map lucigen mates against scaffolds to estimate insert size | | | | | + | | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb | |
| | Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
| | Ask UCSF about the discrepancy in the numbers of reads | | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
| Line 13: | Line 13: | ||
| | Error Correction new data| | | | | | Error Correction new data| | | | | ||
| | Alternate error correction tool | | | | | | Alternate error correction tool | | | | | ||
| - | | Adapter trim new data| | | this will be in addition to the seqprep adapter removal | | + | | Adapter trim new data (Skewer) SW018 and SW019| Chaves| Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| |
| - | + | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | |
| - | + | ||
| - | + | ||
| - | + | ||
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
