This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/08 22:15] nsaremi |
archive:specific_task [2015/05/09 00:27] gepoliano |
||
---|---|---|---|
Line 13: | Line 13: | ||
| Error Correction new data| | | | | | Error Correction new data| | | | | ||
| Alternate error correction tool | | | | | | Alternate error correction tool | | | | | ||
- | | Adapter trim new data| | | this will be in addition to the seqprep adapter removal | | + | | Adapter trim new data (Skewer) **SW018 and SW019**| Chaves| Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| |
+ | |||
+ | |||