archive:specific_task
Differences
This shows you the differences between two versions of the page.
| Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
|
archive:specific_task [2015/05/08 22:14] nsaremi |
archive:specific_task [2015/05/10 07:14] charles |
||
|---|---|---|---|
| Line 3: | Line 3: | ||
| |Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
| - | | Map lucigen mates against scaffolds to estimate insert size | | | | | + | | Map lucigen mates against scaffolds to estimate insert size | Dudek | in progress | I need more scaffolds over 10kb | |
| | Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
| + | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
| + | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
| | Ask UCSF about the discrepancy in the numbers of reads | | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
| | Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| | Merge/trim new data (SeqPrep) | Hussain | in progress | | | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | ||
| - | | Analyze new data (preqc) | | | | | + | | Analyze new data (preqc) | Richardson | In progress | | |
| - | | Analyze new data (fastqc) | Saremi |Completed | located: /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc | + | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | |
| - | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | + | |
| | Analyze SeqPrep results | | | | | | Analyze SeqPrep results | | | | | ||
| - | | Error Correction new data| | | | | + | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | |
| - | | Adapter trim new data| | | this will be in addition to the seqprep adapter removal | | + | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| |
| - | + | | Install bowtie | Chaves | Completed |/campusdata/gchaves/Bowtie/bowtie2-2.2.5| | |
| - | + | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | |
| - | + | ||
| - | + | ||
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52
Except where otherwise noted, content on this wiki is licensed under the following license: CC Attribution-Noncommercial-Share Alike 3.0 Unported
