User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/08 22:09]
nsaremi
archive:specific_task [2015/05/09 00:33]
gepoliano
Line 9: Line 9:
 | Merge/trim new data (SeqPrep) | Hussain | in progress | | | Merge/trim new data (SeqPrep) | Hussain | in progress | |
 | Analyze new data (preqc) | | | |  ​ | Analyze new data (preqc) | | | |  ​
-| Analyze new data (fastqc) | Saremi |Completed | |  ​+| Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc ​|  ​
 | Analyze SeqPrep results | | | |  | Analyze SeqPrep results | | | | 
 | Error Correction new data| | | | | Error Correction new data| | | |
-| Adapter trim new data| | | this will be in addition to the seqprep adapter removal ​+| Alternate error correction tool  | | | | 
- +| Adapter trim new data (Skewer) ​ SW018 and SW019ChavesCompleted ​|/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)
- +| Install bowtie | Chaves | Completed |/​campusdata/​gchaves/​Bowtie/​bowtie2-2.2.5|
- +
- +
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52