This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/08 21:38] sihussai |
archive:specific_task [2015/05/16 02:17] ceisenhart |
||
---|---|---|---|
Line 3: | Line 3: | ||
|Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
- | | Map lucigen mates against scaffolds to estimate insert size | | | | | + | | Find genes in the mitochondrial genome | unassigned | | The genome is on the browser, find it here https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | |
| Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
- | | Ask UCSF about the discrepancy in the numbers of reads | | | | | + | | Ask UCSF about the discrepancy in the numbers of reads | | | I don't see any discrepancy in the number of reads, perhaps this can be removed? | |
- | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | + | |
- | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | + | |
- | | Analyze new data (preqc, fastqc, etc) | | | | | + | |
| Analyze SeqPrep results | | | | | | Analyze SeqPrep results | | | | | ||
- | + | | UCSC Genome browser hub | Eisenhart | Complete | https://banana-slug.soe.ucsc.edu/banana_slug_genome_browser | | |
+ | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
+ | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | | ||
+ | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
+ | | Merge/trim new data (SeqPrep) | Hussain | Completed | See wiki page for each data set for details | | ||
+ | | Analyze new data (preqc) | Richardson | In progress | | | ||
+ | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | ||
+ | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | ||
+ | | Preqc on new mate pair SW041 SW042| Saremi | Completed | | | ||
+ | | Update the wiki to include mate pair meta data | Eisenhart | completed | | ||
+ | | Install CEGMA dependencies | Markello | In progress | Issue discovered: glib required for complete installation of genewise (CEGMA dependency), will use current installation of genewise. | | ||
+ | | Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF50%run/bigContigs.fa | | ||
+ | | Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | | ||
+ | | Map lucigen mates against scaffolds | Dudek | completed | See sam file at /campusdata/ndudek/mapping_lucigen/5kb_plus_discovar/IJS8_mates_vs_discovar_bigContigs_5000.sam | | ||
+ | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
+ | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
+ | |SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://banana-slug.soe.ucsc.edu/team_5_page:sspacesummaryfile | | ||
+ | | Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /campusdata/BME235/mitochondrion | | ||