User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
archive:specific_task [2015/05/08 20:47]
sihussai
archive:specific_task [2015/08/04 03:32]
68.180.228.52 ↷ Links adapted because of a move operation
Line 3: Line 3:
  
 |Task| Assignee | Status | Notes| |Task| Assignee | Status | Notes|
-Map lucigen mates against scaffolds ​to estimate ​insert size | | | | +|Install Maker| Houser | Complete | Maker is installed, see information [[archive:​maker|here]] | 
-| Plot contig size vs total genome size for assemblies | | | | +|Assemble repeat genome with RepArk|Team 1|In progress|Charles has started a test run using the original Hiseq and Miseq reads| 
-| Ask UCSF about the discrepancy in the numbers of reads | | | | +|Run GapCloser on SOAP denovo assembly|Charles|In progress| Use SOAP denovo'​s external gap closer. Chose a reasonable name for new assembly. | 
 +|Find virus contigs and use PRICE to expand to full viruses | Cole,​jolespin | | jolespin virus assembly progress can be accessed at [[archive:​jolespin_virus]]| 
 +| Mate-pair adapter and linker removal| ​ | | | 
 +| Measuring ​insert size for each mate-pair library ​unassigned | | | 
 +| Making Seqprep, adapter removed, end-trimmed library files | unassigned | | | 
 +| Blast long contigs and analyze results | unassigned| | Check the browser for the 30 longest contigs from each group with contigs|  
 +| Find genes in the mitochondrial genome | unassigned | | The genome is on the browser, find it here https://​banana-slug.soe.ucsc.edu/​banana_slug_genome_browser |  
 +| Use PRICE to get mitochondrial genome as single contig | Natasha Dudek? ​| | | 
 +| Plot contig size vs total genome size for assemblies | unassigned ​| | | 
 +| Ask UCSF about the discrepancy in the numbers of reads | unassigned | | I don't see any discrepancy in the number of reads, perhaps this can be removed? ​ |  
 +| Fastqc/​kmergenie on SeqPrepped data | unassigned | waiting on previous steps | |  
 +| End trim SeqPrepped data | Hussain | | |  
 +| Error correct SeqPrepped data | McGovern | waiting on previous step | |  
 +| Error Correction new data| McGovern (Musket) | In progress |  | 
 +| Install bowtie | Chaves | In progress |/​campusdata/​gchaves/​Bowtie/​bowtie2-2.2.5 (Not yet running successfully)| 
 +| UCSC Genome browser hub | Eisenhart | Complete | https://​banana-slug.soe.ucsc.edu/​banana_slug_genome_browser |  
 +| Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | Complete | | 
 +| Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello ​Complete ​| |
 | Find cost of creating a tagmentase library| Dudek | | ~$50 | | Find cost of creating a tagmentase library| Dudek | | ~$50 |
-| Merge/trim new data (SeqPrep) | Hussain | in progress ​| | +| Merge/trim new data (SeqPrep) | Hussain | Completed ​See wiki page for each data set for details ​
-| Analyze new data (preqc, fastqc, etc) | | | |   +| Analyze new data (preqc) | Richardson | Completed | See wiki page for each data set for details |  
- +| Preqc on new mate pair SW041 SW042| Saremi | Completed | | 
 +| Update the wiki to include mate pair meta data | Eisenhart | completed |  
 +| Install CEGMA dependencies | Markello | Completed | Issue discovered: glib required for complete installation of latest version of genewise (CEGMA dependency) on head nodewill use current installation of genewise. | 
 +| Create a file containing contigs longer than 5kb | Eisenhart | completed | file is here /​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF50%run/​bigContigs.fa | 
 +| Plot scaffold size histogram for current assembly (Discovar de novo results) | Dudek | Completed | 10% and the new UCSF 50% are up on the discovar team page | 
 +| Map lucigen mates against scaffolds | Dudek | completed | See sam file at /​campusdata/​ndudek/​mapping_lucigen/​5kb_plus_discovar/​IJS8_mates_vs_discovar_bigContigs_5000.sam | 
 +| Analyze new data (fastqc) | Saremi ​|Completed ​/​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc ​|   
 +| Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| 
 +|SSpace on discovar de novo assembly fasta | Eisenhart | Complete | Results are posted here , https://​banana-slug.soe.ucsc.edu/​team_5_page:​sspacesummaryfile |  
 +| Map reads against 2012 mitochondrion assembly | Dudek | Completed for UCSF SW018 and SW019 reads | I did the mapping both for adapter-trimmed and adapter-trimmed & duplicate-free reads. The sam files are available at: /​campusdata/​BME235/​mitochondrion |
  
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52