This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/08 20:47] sihussai |
archive:specific_task [2015/05/12 05:06] ceisenhart |
||
---|---|---|---|
Line 3: | Line 3: | ||
|Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
- | | Map lucigen mates against scaffolds to estimate insert size | | | | | ||
| Plot contig size vs total genome size for assemblies | | | | | | Plot contig size vs total genome size for assemblies | | | | | ||
| Ask UCSF about the discrepancy in the numbers of reads | | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
+ | | Analyze SeqPrep results | | | | | ||
+ | | Preqc on new mate pair SW041 SW042| | | | | ||
+ | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
+ | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
| Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
| Merge/trim new data (SeqPrep) | Hussain | in progress | | | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | ||
- | | Analyze new data (preqc, fastqc, etc) | | | | | + | | Analyze new data (preqc) | Richardson | In progress | | |
- | + | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | |
+ | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | ||
+ | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | ||
+ | | Map lucigen mates against scaffolds to estimate insert size | Dudek | Completed | There seem to be technical issues with the lucigen mate pair reads. Average read length is 40bp and average insert size is ~220bp, compared to an expected read length of 300bp and insert size over 1kb. Also, I spoke with Brendan and there is new mate-pair data coming soon (expected the week of May 10th). | | ||
+ | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
+ | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
+ | |SSpace on discovar de novo assembly fasta | Eisenhart | In process | queued | | ||