User Tools

Site Tools


archive:specific_task

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
Next revision Both sides next revision
archive:specific_task [2015/05/08 20:36]
sihussai
archive:specific_task [2015/05/09 00:27]
gepoliano
Line 1: Line 1:
-=====Tasks===== +======Tasks====== 
-Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. +Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary
  
 |Task| Assignee | Status | Notes| |Task| Assignee | Status | Notes|
Line 7: Line 7:
 | Ask UCSF about the discrepancy in the numbers of reads | | | |  | Ask UCSF about the discrepancy in the numbers of reads | | | | 
 | Find cost of creating a tagmentase library| Dudek | | ~$50 | | Find cost of creating a tagmentase library| Dudek | | ~$50 |
 +| Merge/trim new data (SeqPrep) | Hussain | in progress | |
 +| Analyze new data (preqc) | | | |  ​
 +| Analyze new data (fastqc) | Saremi |Completed | /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-MK_fastqc /​campusdata/​BME235/​S15_assemblies/​SOAPdenovo2/​Fastqc/​UCSF_BS-tag_fastqc |  ​
 +| Analyze SeqPrep results | | | | 
 +| Error Correction new data| | | |
 +| Alternate error correction tool  | | | |
 +| Adapter trim new data (Skewer) ​ **SW018 and SW019**| Chaves| Completed |/​campusdata/​BME235/​S15_assemblies/​DiscovarDeNovo/​UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)|
 +
 +
 +
 +
 +
  
  
  
archive/specific_task.txt · Last modified: 2015/08/04 03:32 by 68.180.228.52