This shows you the differences between two versions of the page.
Both sides previous revision Previous revision Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/08 20:36] sihussai |
archive:specific_task [2015/05/09 00:27] gepoliano |
||
---|---|---|---|
Line 1: | Line 1: | ||
- | =====Tasks===== | + | ======Tasks====== |
- | Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. | + | Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary. |
|Task| Assignee | Status | Notes| | |Task| Assignee | Status | Notes| | ||
Line 7: | Line 7: | ||
| Ask UCSF about the discrepancy in the numbers of reads | | | | | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
| Find cost of creating a tagmentase library| Dudek | | ~$50 | | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
+ | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | ||
+ | | Analyze new data (preqc) | | | | | ||
+ | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
+ | | Analyze SeqPrep results | | | | | ||
+ | | Error Correction new data| | | | | ||
+ | | Alternate error correction tool | | | | | ||
+ | | Adapter trim new data (Skewer) **SW018 and SW019**| Chaves| Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_SW18_SW019_trimmed (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||