This shows you the differences between two versions of the page.
Next revision | Previous revision Next revision Both sides next revision | ||
archive:specific_task [2015/05/08 17:45] gepoliano created |
archive:specific_task [2015/05/12 03:02] nsaremi |
||
---|---|---|---|
Line 1: | Line 1: | ||
- | |Name|Task| | + | ======Tasks====== |
+ | Use this page to create and claim tasks that are relevant to the whole class. Completed tasks should be moved to the bottom of the list. Feel free to break tasks down into smaller subparts if necessary. | ||
+ | |||
+ | |Task| Assignee | Status | Notes| | ||
+ | | Preqc con new mate pair SW041 SW042| | | | | ||
+ | | Plot contig size vs total genome size for assemblies | | | | | ||
+ | | Ask UCSF about the discrepancy in the numbers of reads | | | | | ||
+ | | Analyze SeqPrep results | | | | | ||
+ | | Plot contig size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
+ | | Plot scaffold size histogram for current assembly (SOAPdenovo2 results) | Markello | In progress | | | ||
+ | | Find cost of creating a tagmentase library| Dudek | | ~$50 | | ||
+ | | Merge/trim new data (SeqPrep) | Hussain | in progress | | | ||
+ | | Analyze new data (preqc) | Richardson | In progress | | | ||
+ | | Error Correction new data| McGovern (Musket) & Richardson (BLESS/racer) | In progress | These programs have not yet been run succesfully... | | ||
+ | | Install bowtie | Chaves | In progress |/campusdata/gchaves/Bowtie/bowtie2-2.2.5 (Not yet running successfully)| | ||
+ | | Install CEGMA dependencies | Markello | In progress | Relying on IT to fix issues with completing compilation of wise2 (genewise) package which CEGMA requires | | ||
+ | | Map lucigen mates against scaffolds to estimate insert size | Dudek | Completed | There seem to be technical issues with the lucigen mate pair reads. Average read length is 40bp and average insert size is ~220bp, compared to an expected read length of 300bp and insert size over 1kb. Also, I spoke with Brendan and there is new mate-pair data coming soon (expected the week of May 10th). | | ||
+ | | Analyze new data (fastqc) | Saremi |Completed | /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc /campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-tag_fastqc | | ||
+ | | Adapter trim UCSF SW018 and SW019 libraries (skewer), remove duplicates (fastUniq)| Chaves & Dudek | Completed |/campusdata/BME235/S15_assemblies/DiscovarDeNovo/UCSF_reads (Read 1 Sequencing Primer: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3'; Read 2 Sequencing Primer: 5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3)| |