Differences

This shows you the differences between two versions of the page.

--- archive:bioinformatic_tools:bwa [2011/05/16 19:27]
svohr
+++ archive:bioinformatic_tools:bwa [2011/05/20 18:03]
svohr
@@ Line 28: / Line 28: @@
 bwa sampe database.fasta aln_sa1.sai aln_sa2.sai read1.fq read2.fq > aln.sam
 </code>
+===== Quirks =====
+The SAM formatted alignments include a column labeled "inferred insert length" by the BWA manual, but in the SAM specification it is described as the "template length" or distance between the leftmost mapped base to the rightmost mapped base. The second description seems to
+match the output of BWA. However, there are some template lengths that do not appear to be calculated correctly.
+<code>
+bc07_1.fastq:
+@HWUSI-EAS1722:4:66:6286:18215#CAGATC/1
+AGCAGTCGTCGTGGTATGCCTGGATGTTACAGCAGTCGTCGTGGTATGACTGGATGTTACAGCAGTCGTCGTGGTATGACTGGATGTTACAGCAGTCGTCGTGGTATGACTGGAT
+bc07_2.fastq:
+@HWUSI-EAS1722:4:66:6286:18215#CAGATC/2
+CACGACGACTGCTGTAACATCCAGGCATACCACGACGACTGCTGTAACATCCAGGCATACCACGACGACAGCTATAACATACACTCATACCACGA
+</code>
+For example, these two reads make up a pair that overlaps.
+<code>
+...ACATCCAGTCATACCACGACGACTGCTGTAACATCCAGGCATACCACGACGACTGCT
+                 CACGACGACTGCTGTAACATCCAGGCATACCACGACGACTGCTGTAACATCCAGGCATACCACGACGACAGCTATAACATACACTCATACCACGA
+</code>
+Instead of reporting the total length, the length of the overlap is reported.
+<code>
+HWUSI-EAS1722:4:66:6286:18215#CAGATC	81	GAZ7HUX03HIJAL	272	23	115M	=	344	-43
+HWUSI-EAS1722:4:66:6286:18215#CAGATC	161	GAZ7HUX03HIJAL	344	25	95M	=	272	43
+</code>
+This explains the incorrect short lengths found in our histograms. This does not appear to affect the pairs that do not overlap and most of these overlapping reads that should be combined using SeqPrep.
 ====== Determining Paired-End Insert Size ======

Banana Slug Genomics

User Tools

Site Tools

Differences

Page Tools