Table of Contents

UCSF_SW018

Sequencing data

Library Run Location Notes
/campusdata/BME235/Spring2015Data/UCSF_SW018/

Files

File Size
SW018_TAGTTCC_R1.fastq 31G
SW018_TAGTTCC_R2.fastq 31G
../preqc/ucsf_sw018/ucsf_sw018.fastq 63G
../adapterAndPCRFreeFiles/SW018_noAdap_R1.fastq 28G
../adapterAndPCRFreeFiles/SW018_noAdap_R2.fastq 28G
../adapterAndPCRFreeFiles/UCSF_SW018_noAdap_noDup_R1.fastq 28G
../adapterAndPCRFreeFiles/UCSF_SW018_noAdap_noDup_R2.fastq 28G
../merging/SeqPrep_newData/UCSF_SW018_TAGTTCC_merged.fastq.gz 5.4G
../merging/SeqPrep_newData/UCSF_SW018_TAGTTCC_R1_trimmed.fastq.gz 1.9G
../merging/SeqPrep_newData/UCSF_SW018_TAGTTCC_R2_trimmed.fastq.gz 1.9G
ErrorCorrected/SW018_seqprep_dupRemoved_ec_R1.fastq 38G
ErrorCorrected/SW018_seqprep_dupRemoved_ec_R2.fastq 38G

Fastqc results

SW018_TAGTTCC_R1.fastq

SW018_TAGTTCC_R2.fastq

For both of these files the Kmer content looks a bit concerning

Preqc (SGA preprocessing) results

Sat May 23

ucsf_sw018_preqc_report.pdf

Comments

The preqc report for the ucsf_sw018 reads look similar to previous reports. However, the genome size estimate is low (1.9 compared 2.2 Gb). The ucsf_sw018 is not represented in the k-de Bruijn graphs indicating insufficient coverage to make these predictions. This report provides a useful baseline for comparison with other pre-processing efforts.

Pre processing

The raw fastq files were put through a pre processing pipeline. First the fastq files had adaptor sequences removed using Skewer. The adaptor free files were further processed with FastUniq to remove PCR duplicates.

KmerGenie

Running the merged and trimmed files

predicted best k: 61

KmerGenie Merged SW018 SW019

SeqPrep results

The data files were trimmed using SeqPrep, both with and without merging. The output for the run without merging is in /campusdata/BME235/Spring2015Data/adapter_trimming/SeqPrep_newData and the output for the run with merging is in /campusdata/BME235/Spring2015Data/merging/SeqPrep_newData. The trimmed R1 and R2 files for the run with merging are significantly smaller than those from the non-merging run.

The adapters used for both runs were AGATCGGAAGAGCACACGTCTGAACTCCAG (-A option) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAG (-B option).

Merged SW018 Libraries

All SW018 data sets that had been adapter trimmed using Seqprep were merged with Fastuniq to remove duplicates and then error corrected using Musket