======UCSF_SW018======

===== Sequencing data =====
| Library | Run | Location | Notes | 
| |  |/campusdata/BME235/Spring2015Data/UCSF_SW018/ | |
===== Files =====
| File | Size|
| SW018_TAGTTCC_R1.fastq | 31G |
| SW018_TAGTTCC_R2.fastq | 31G |
| ../preqc/ucsf_sw018/ucsf_sw018.fastq | 63G |
| ../adapterAndPCRFreeFiles/SW018_noAdap_R1.fastq | 28G | 
| ../adapterAndPCRFreeFiles/SW018_noAdap_R2.fastq | 28G |
| ../adapterAndPCRFreeFiles/UCSF_SW018_noAdap_noDup_R1.fastq | 28G| 
| ../adapterAndPCRFreeFiles/UCSF_SW018_noAdap_noDup_R2.fastq | 28G| 
| ../merging/SeqPrep_newData/UCSF_SW018_TAGTTCC_merged.fastq.gz | 5.4G| 
| ../merging/SeqPrep_newData/UCSF_SW018_TAGTTCC_R1_trimmed.fastq.gz | 1.9G| 
| ../merging/SeqPrep_newData/UCSF_SW018_TAGTTCC_R2_trimmed.fastq.gz | 1.9G|
| ErrorCorrected/SW018_seqprep_dupRemoved_ec_R1.fastq | 38G|
| ErrorCorrected/SW018_seqprep_dupRemoved_ec_R2.fastq | 38G|

===== Fastqc results =====
{{::sw018_tagttcc_l001_r1_001.fastq.pdf| SW018_TAGTTCC_R1.fastq}}

{{::sw018_tagttcc_l001_r2_001.fastq.pdf| SW018_TAGTTCC_R2.fastq}}

For both of these files the Kmer content looks a bit concerning

===== Preqc (SGA preprocessing) results =====

Sat May 23

{{::ucsf_sw018_preqc_report.pdf|}}

==== Comments ====

The preqc report for the ucsf_sw018 reads look similar to previous reports. However, the genome size estimate is low (1.9 compared 2.2 Gb). The ucsf_sw018 is not represented in the k-de Bruijn graphs indicating insufficient coverage to make these predictions. This report provides a useful baseline for comparison with other pre-processing efforts.

=====Pre processing=====
The raw fastq files were put through a pre processing pipeline. First the fastq files had adaptor sequences removed using Skewer. The adaptor free files were further processed with FastUniq to remove PCR duplicates. 

=====KmerGenie=====
Running the merged and trimmed files

predicted best k: 61

{{:ucsf_sw018_sw019_report.pdf|KmerGenie Merged SW018 SW019}}

=====SeqPrep results=====
The data files were trimmed using SeqPrep, both with and without merging. The output for the run without merging is in /campusdata/BME235/Spring2015Data/adapter_trimming/SeqPrep_newData and the output for the run with merging is in /campusdata/BME235/Spring2015Data/merging/SeqPrep_newData. The trimmed R1 and R2 files for the run with merging are significantly smaller than those from the non-merging run.

The adapters used for both runs were AGATCGGAAGAGCACACGTCTGAACTCCAG (-A option) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAG (-B option). 

===== Merged SW018 Libraries =====
All SW018 data sets that had been adapter trimmed using Seqprep were merged with Fastuniq to remove duplicates and then error corrected using Musket