======BS-MK======

===== Sequencing data =====
| Library | Run | Location | Notes | 
| |  |/campusdata/BME235/Spring2015Data/UCSF_BS-MK/ | |
===== Files =====
| File | Size|
| BS-MK_CATCCGG_R1.fastq | 83G |
| BS-MK_CATCCGG_R2.fastq | 83G |
| ../preqc/ucsf_bs-mk/ucsf_bs-mk.fastq | 172G |
| ../adapter_trimming/UCSF_reads_skewer_trimmed/BS_MK_noAdap_R1.fastq | 83G |
| ../adapter_trimming/UCSF_reads_skewer_trimmed/BS_MK_noAdap_R2.fastq | 83G |
| ../merging/SeqPrep_newData/UCSF_BS-MK_CATCCGG_merged.fastq.gz | 11G|
| ../merging/SeqPrep_newData/UCSF_BS-MK_CATCCGG_R1_trimmed.fastq.gz | 22G |
| ../merging/SeqPrep_newData/UCSF_BS-MK_CATCCGG_R2_trimmed.fastq.gz | 22G |




/campusdata/BME235/S15_assemblies/SOAPdenovo2/errorCorrectionTask/musket_run/pairedEndEC_k31_minmult3/BS-MK_seqprep_dupRemoved_ec_R1.fastq

/campusdata/BME235/S15_assemblies/SOAPdenovo2/errorCorrectionTask/musket_run/pairedEndEC_k31_minmult3/BS-MK_seqprep_dupRemoved_ec_R2.fastq



A grep search shows that within the raw data files only 0.06% of reads contain the full adapter sequence.

==== FastQC results ====

Results of the run are located here on the campusrocks2 server:

/campusdata/BME235/S15_assemblies/SOAPdenovo2/Fastqc/UCSF_BS-MK_fastqc

{{:fastqc_bs-mk_catccgg_r1.pdf|}}

{{:fastqc_bs-mk_catccgg_r2.pdf|}}

** Skewer Adapter trimmed fastqc results **

Results of fastqc analysis on the adapter trimmed (using skewer) and PCR duplicate removed (using fastuniq) files:


forward adapter used: ACACTCTTTCCCTACACGACGCTCTTCCGATCT


reverse adapter used: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

{{:fastqc_bs_mk_noadap_r1.pdf|}}

{{:fastqc_bs_mk_noadap_r2.pdf|}}


The "no-adap" sequences look like they still have a high-frequency kmer at the beginning: GCTCTTCCGATCTA, which looks like the claimed -B option AGATCGGAAGAGCGTCGTGTAGGGAAAGAG, which complements to CTCTTTCCCTACACGACGCTCTTCCGATCT

Was adapter trimming done correctly? Why did Skewer not remove the adapter sequence?

Skewer was not run properly. It was redone with the adapters:
Forward: AGATCGGAAGAGCACACGTCTGAACTCCAG
Reverse: AGATCGGAAGAGCGTCGTGTAGGGAAAGAG

Here are the new fastqc results:

{{:bs_mk_noadap_r1.fastq_fastqc_report.pdf| fastqc report for v2 BS-MK R1 trimmed reads}}

{{:bs_mk_noadap_r2.fastq_fastqc_report.pdf| fastqc report for v2 BS-MK R2 trimmed reads}}

There is still a failing k-mer content.


** Seqprep Adapter trimmed fastqc results **

Results of fastqc analysis on the seqprep adapter trimmed files:

{{::fastqc_ucsf_bs-mk_catccgg_r1_tr....fastq.gz_fastqc_report.pdf|}}

{{:fastqc_ucsf_bs-mk_catccgg_r2_tr....fastq.gz_fastqc_report.pdf|}}

These fastqc analyses show a huge amount of adapter at the beginnings of the reads.  Was SeqPrep told about the adapters?  What parameters was it run with?


===== Preqc (SGA preprocessing) results =====

Tues May 26

{{::ucsf_bs-mk_preqc_report.pdf|}}

Preqc report of the UCSF BS-MK and BS-tag data (pooled).

{{:ucsf_new_lib_preqc_report.pdf|}}

==== Comments ====

The preqc report for the ucsf_bs-mk reads look similar to previous reports. This report provides a useful baseline for comparison with other pre-processing efforts.


=====SeqPrep results=====
The data files were trimmed using SeqPrep, both with and without merging. The output for the run without merging is in /campusdata/BME235/Spring2015Data/adapter_trimming/SeqPrep_newData and the output for the run with merging is in /campusdata/BME235/Spring2015Data/merging/SeqPrep_newData. The trimmed R1 and R2 files for the run with merging are somewhat smaller than those from the non-merging run.

The adapters used for both runs were AGATCGGAAGAGCACACGTCTGAACTCCAG (-A option) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAG (-B option). 

===FastQC on Seqprep, Fastuniq, Musket files===

Seqprep adapter removed files were run through Fastuniq to remove PCR duplicates, then through musket for error correction, and lastly FastQC for analysis

{{::bs-mk_seqprep_dupremoved_ec_r1.pdf|}}

{{::bs-mk_seqprep_dupremoved_ec_r2.pdf|}}

Files are located here:

/campusdata/BME235/S15_assemblies/SOAPdenovo2/errorCorrectionTask/musket_run/pairedEndEC_k31_minmult3/BS-MK_seqprep_dupRemoved_ec_R1.fastq

/campusdata/BME235/S15_assemblies/SOAPdenovo2/errorCorrectionTask/musket_run/pairedEndEC_k31_minmult3/BS-MK_seqprep_dupRemoved_ec_R2.fastq