===== Sequencing data =====
| Library | Run | Location | Notes | 
| SW042 |  |/campusdata/BME235/Spring2015Data/ | Mate pair library. Expected insert size is 5-6kb. |

===== Files =====
| File | Size| Reads| 
| SW042.r1.trimmed.fastq | 152M| 1,036,699 |
| SW042.r2.trimmed.fastq | 153M| 1,086,654 |
| Matepair_trimmed/skewer_run2_SW042_1_trimmed-pair1.fastq | 145M| 735,906 |
| Matepair_trimmed/skewer_run2_SW042_1-trimmed-pair2.fastq | 140M| 735,906 |
| Matepair_dupRemoved/skewer_42_dupRemoved_R1.fastq | 129M| 657,883 |
| Matepair_dupRemoved/skewer_42_dupRemoved_R2.fastq | 125M| 657,883 |



Note: Duplicates, concatemers, and linkers have already been removed in the “trimmed” files.

===== FastQC analysis =====

There are several summary statistics that fastqc flags as potentially unusual such as the per base sequence content and kmer content.

{{:sw042.r1.trimmed.fastq_fastqc_report.pdf| Fastqc results for SW042.r1.trimmed.fastq}}

{{:sw042.r2.trimmed.fastq_fastqc_report.pdf| Fastqc results for SW042.r2.trimmed.fastq}}

=====PreQC analysis=====

Run on SW042.r1.trimmed.fastq and SW042.r2.trimmed.fastq

{{:preqc_report_sw042.pdf| Preqc for SW042}}

=====Insert size distribution=====

The distribution of insert sizes for inward facing, outward facing, and same strand reads is shown below. Mate pairs should be outward facing.

{{:sw042_insert_size_distribution.jpg?200|}}

To generate this distribution, mates pairs were mapped to all the soapdenovo "run 1" contigs using bwa. The orientation of reads was pulled from the resulting sam file using a script from the Green lab. 

=====Pre-processing=====

===Adapter Removal with Skewer===
Running skewer with a junction sequence of 

CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG

skewer-0.1.123-linux-x86_64 -x CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -y CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -m mp -j CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -t 32 -o ${OUTDIR} /campusdata/BME235/Spring2015Data/SW042.r1.trimmed.fastq /campusdata/BME235/Spring2015Data/SW042.r2.trimmed.fastq


Using the adapter sequences obtained from this paper [[http://www.illumina.com/documents/products/technotes/technote_nextera_matepair_data_processing.pdf| Nextera Mate Pair Kit]]

Files located here:

/campusdata/BME235/Spring2015Data/Matepair_trimmed/skewer_run2_SW042_1-trimmed-pair1.fastq

/campusdata/BME235/Spring2015Data/Matepair_trimmed/skewer_run2_SW042_1-trimmed-pair2.fastq

**Fastqc results**


{{::skewer_run2_sw042_1-pair1fastq.pdf|}}


{{::skewer_run2_sw042_1-pair2fastq.pdf|}}



===Fastuniq to remove duplicates===
Fastuniq was run to remove any duplicates still remaining after adapter removal 

Files located here:

/campusdata/Spring2015Data/Matepair_dupRemoved/skewer_42_dupRemoved_R1.fastq

/campusdata/Spring2015Data/Matepair_dupRemoved/skewer_42_dupRemoved_R2.fastq

**Fastqc results**

{{::fastqc_skewer_42_dupremoved_r1.pdf|}}


{{::fastqc_skewer_42_dupremoved_r2.pdf|}}